Comparison of model-based predictions and real neuronal responses | We measured the minimum latency of acoustic pulse train responses (see Methods), and found a statistically significant difference between synchronized and non-synchronized neurons, within both our simulated and real neuronal populations |
Comparison of model-based predictions and real neuronal responses | We observed a statistically significant difference between synchronized and non-synchronized responses in both simulated and real neurons (Fig. |
Comparison of model-based predictions and real neuronal responses | This difference was not due to a slightly longer latency response in non-synchronizing neurons, as we also observed a statistically significant difference between synchronized and non-synchronized neurons when the time window used to calculate the onset discharge rate was lengthened to 100 ms |
Data analysis | A synchronized neuron was required to have statistically significant vector strength at the longest IPI tested (Rayleigh statistic> 13.8, P<0.001, at IPI = 75ms). |
Data analysis | Values of the Rayleigh statistic greater than 13.8 were considered statistically significant (P < 0.001) [25]. |
Methods). | While non-synchronized neurons had a slightly higher pure tone evoked response to pure tones than synchronized neurons, this difference was not statistically significant (Wil-coxon rank sum test, P = 0.58, uncorrected). |
Methods). | Although we only observed a statistically significant difference between synchronized and mixed response neurons for the stimulus synchronization limit and not maximum vector strength, this may be due to the limited number of mixed response neurons that we were able to record from |
Methods). | While for simulated neurons with the same excitatory input strength, the stimulus synchronization limit of synchronized neurons decreased as the I/E ratio increased (P<0.001, Spearman correlation coefficient), we did not observe a statistically significant trend between the stimulus synchronization limit and I/ E ratio in mixed response neurons (P>0.05, Spearman correlation coefficient). |
Model parameters underlying rate and temporal representations | 4b) between the excitatory input strength and the Rayleigh statistic, the criterion we used to measure the statistical significance of stimulus-synchronization. |
Model parameters underlying rate and temporal representations | We observed a statistically significant correlation (r = 0.87, P< 1.5 X 10'”, Spearman Correlation, Fig. |
Responses to pulse trains in real and simulated cortical neurons | A synchronized neuron was required to have statistically significant vector strength at the longest IPI tested (Rayleigh statistic> 13.8, P<0.001, at IPI = 75ms) [25]. |
Flexibility peaks are localized at tandem repeats inside 3’UTR regions | This is not coherent with 1:2:1 ratio distribution of the yeast genome, making the difference statistically significant for the converging regions (Fisher test: |
Flexibility peaks map on polyadenylation signals | We identified, as expected, a TATATATATATATATATGTATAT motif (MEME statistical significance E-value = 4.6 X 10—585) in 145 peaks and a ATTATTAT-TATTATTATTATTATTATT motif (MEME statistical significance E-value = 3.7 x 10—119) in 32 of them. |
Flexibility peaks map on polyadenylation signals | peak regions, comprehensive of additional 100m upstream and downstream), we found that in 183 sites the novel A/T-rich motif CTTCTTTTCTTC (MEME statistical significance E-function since it again occurs in all interORF peak regions. |
Statistical analysis | The statistical significance of properties and classifications has been assessed by means of Fish-er’s exact test and t-test. |
Statistical analysis | Differently, When external classifications have been used, statistical significance has been imported With the results. |
Statistical analysis | As stated by the authors in [26] , MEME usually finds the most statistically significant (low E-Value) motifs first. |
Abstract | However for the rest of mutations outside of the active site we observed a weak yet statistically significant positive correlation between thermal stability and catalytic activity indicating the lack of a stability-activity tradeoff for DHFR. |
Comparison with other methods | PopMusic shows also strong performance with highly statistically significant 1’ = 0.55 between theory and experiment, however the limitation of this method is that it can consider only single point mutations. |
Discussion | A straightforward explanation for the weak yet statistically significant positive correlation between activity and stability observed in our case might be that more stable proteins have greater effective concentration of the folded (i.e. |
Discussion | It is also important to note that a weak yet statistically significant positive correlation between activity and stability for DHFR can be revealed only when stabilizing mutations are included in the analysis. |
Discussion | Our earlier study [48] analyzed a smaller set of primarily destabilizing mutants and did not reveal any statistically significant trend (positive or negative) in the stability-activity relation for DHFR. |
Experimental characterization of predicted mutants | Given that statistically most random mutations are destabiliz-ing with only a small fraction (less than 18%) stabilizing [8,12], this statistically significant result (p = 0.002 under the null hypothesis that mutations are random) indicates that MCPU is an effective method for selecting stability-enhancing mutations. |
OOPPCOOPC. | However, if the COOP is ever found to be statistically significantly greater than COOPC, it will be essential to reevaluate the applicability of the parameter. |
OOPPCOOPC. | If the error in the system is so large that there is no statistically significant difference between the boundaries (COOPu and COOPC), it would not be possible to differentiate between the regions. |
OOPPCOOPC. | To estimate the error and sample size, we calculated the propagation of error in COOPu and COOPC, and used them in the student t-test to calculate statistical significance . |
Supporting Information | Statistical significance at p< 0.05, With OOP error of O'OOP = |
Discussion | Similarly, our models predicted that IgG4 has a negative impact on functional level, and an analogous depletion experiment did exhibit this trend across 2 different vaccine regimens, although the increase in activity in the RV144 samples when IgG4 was depleted did not meet statistical significance [23]. |
Supervised learning: Classification | Thus we see, for example, that the two dominant and statistically significant (at an unadjusted 0.05 level) contributors to predicting ADCP class are IgG1.gp120 and IgG3.p24, capturing both key subclasses with two different antigen specificities. |
Supervised learning: Classification | While not achieving statistically significant confidence in the coefficient value, negative contributions from IgG2 were also observed, consistent with the unsupervised analysis and the reduced ability of this subclass to bind to FcyR on phagocytes presumably due to blocking (i.e., preferred binding of antibodies with better affinity). |